Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-hSyn-FLEX-TVA-P2A-EGFP-2A-oG
(Plasmid #85225)

Ordering

This material is available to academics and nonprofits only. This item is currently unavailable outside the US without additional regulatory approval. A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.
Item Catalog # Description Quantity Price (USD)
Plasmid 85225 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-syn-FLEX-splitTVA-eGFP-B19G IW
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Optimized G Protein
  • Alt name
    oG
  • Species
    Synthetic
  • Insert Size (bp)
    1575
  • Promoter hSyn

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer AGTCGTGTCGTGCCTGAGAG
  • 3′ sequencing primer CGGGATCACTCTCGGCATGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Enhanced GFP
  • Alt name
    EGFP
  • Species
    Synthetic
  • Insert Size (bp)
    717

Gene/Insert 3

  • Gene/Insert name
    TVA
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    468

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Optimized G protein was provide by Euiseok Kim and Ed Callaway at the Salk Institute.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-FLEX-TVA-P2A-EGFP-2A-oG was a gift from John Naughton (Addgene plasmid # 85225 ; http://n2t.net/addgene:85225 ; RRID:Addgene_85225)