pAAV-synP-FLEX-splitTVA-EGFP-B19G
(Plasmid #52473)

• Purpose: Expresses splitTVA-EGFP-B19G
• Depositing Lab: Ian Wickersham
• Publication: Kohara et al Nat Neurosci. 2014 Feb;17(2):269-79. doi: 10.1038/nn.3614. Epub 2013 Dec 15.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4436
• Total vector size (bp): 7325
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Stbl3 at 37C
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TVA-P2A-EGFP-P2A-B19G
• Species: Synthetic
• Insert Size (bp): 2889
• Promoter: Synapsin-1

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CTGCGTATGAGTGCAAG TGTGTTGCGTAGGTTCTG TTGAGTTTGCATGCTCC TCGTGTAAATAGGGAATTTC
• 3′ sequencing primer: cagcgtatccacatagcg

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 13 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternative plasmid name: pAAV-synP-FLEX-sTpEpB

Information for AAV1 (Catalog # 52473-AAV1)

Purpose

Ready-to-use AAV1 particles produced from pAAV-synP-FLEX-splitTVA-EGFP-B19G (#52473). In addition to the viral particles, you will also receive purified pAAV-synP-FLEX-splitTVA-EGFP-B19G plasmid DNA.

Helper virus for monosynaptic tracing with rabies virus. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
• Buffer: PBS + 0.001% Poloxamer 188
• Serotype: AAV1
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: EGFP (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Dr. Wickersham has tested this lot#v14715 (2.4 × 10^13 GC∕mL) and he recommends a 1:10 dilution.

When selecting what system to use, keep in mind that the sTpEptTA (Addgene#100798) + TRE (Addgene# 100799) combination allows reduction of background infection by Rabies Virus in wild-type mice to acceptably few cells while still allowing nice amounts of transsynaptic spread in Cre+ mice. Note that EGFP can be seen only with immunostaining at these dilutions. This vector (Addgene #52473) is simpler because you only need to inject a single AAV but forces a less optimal compromise: more background or less transsynaptic spread.

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.