pSB1A3 EcoRI-RTX with EcoRI Methylase-AmilCP
(Plasmid #85165)

• Purpose: Provides the coding region to express the EcoRI restriction enzyme. The RTX tag allows the EcoRI enzyme to be isolated via calcium-precipitation.
• Depositing Lab: Robin Dowell
• Publication: Hendrix et al ACS Synth Biol. 2014 Dec 19;3(12):969-71. doi: 10.1021/sb500042m.

Backbone

• Vector backbone: pSB1A3
• Backbone manufacturer: iGEM
• Backbone size w/o insert (bp): 2155
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EcoRI-RTX and EcoRI Methylase-AmilCP coding sequences
• Alt name: RTX tagged EcoRI restriction enzyme
• Species: E. coli strain RY13
• Insert Size (bp): 3020
• Promoter: J23100 promoter
• Tags / Fusion Proteins:
  • AmilCP (C terminal on insert)
  • RTX (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI, XbaI (not destroyed)
• 3′ cloning site: SpeI, PstI (not destroyed)
• 5′ sequencing primer: VF2 (5' tgccacctgacgtctaagaa 3')
• 3′ sequencing primer: VR (5' attaccgcctttgagtgagc 3')

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Promoter and AmilCP were acquired from iGEM repository.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

AmilCP is fused to the EcoRI Methylase. RTX tag is fused to the EcoRI restriction enzyme.
The methylase will methylate the EcoRI cloning site, rendering the site nonfunctional.