Skip to main content
Addgene

pLV-mTurquoise-MLC-IRES-neo
(Plasmid #85145)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85145 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLV-EF1a-IRES-Neo
  • Backbone size w/o insert (bp) 8980
  • Total vector size (bp) 10208
  • Vector type
    Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mTurquoise-MLC (myosin regulatory light chain, N-terminally tagged with mTurquoise
  • Alt name
    MYL9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1245
  • GenBank ID
    NM_006097.3
  • Entrez Gene
    MYL9 (a.k.a. LC20, MLC-2C, MLC2, MMIHS4, MRLC1, MYRL2)
  • Promoter EF1a
  • Tag / Fusion Protein
    • mTurquoise (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer ACACCGGCCTTATTCCAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To reduce EF1a-driven expression, a uORF (ACCATGGGTTGAACC) has been inserted between EF1a and mTurquoise.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-mTurquoise-MLC-IRES-neo was a gift from Tobias Meyer (Addgene plasmid # 85145 ; http://n2t.net/addgene:85145 ; RRID:Addgene_85145)
  • For your References section:

    Engulfed cadherin fingers are polarized junctional structures between collectively migrating endothelial cells. Hayer A, Shao L, Chung M, Joubert LM, Yang HW, Tsai FC, Bisaria A, Betzig E, Meyer T. Nat Cell Biol. 2016 Dec;18(12):1311-1323. doi: 10.1038/ncb3438. Epub 2016 Nov 14. 10.1038/ncb3438 PubMed 27842057