pUASTattb-cAMPr Y205A, R626A
(Plasmid
#84932)
-
PurposecAMPr under 5x UAS regulation. pUASTTB for phiC site mediated insertion. Y205A mutation inhibits PKA-C kinase activity. R626A should decrease affinity for cAMP without affecting specifity.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepuastattb
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 10700
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecAMPr Y205A R626A
-
SpeciesSynthetic
-
Insert Size (bp)2300
-
MutationPKA-C Y205A, PKA-R R626A
- Promoter 5X UAS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGGAATTGGGAATTCAAAATGGGCAACGCCGCCGCCGCCAAGAAG
- 3′ sequencing primer ATCTGTTAACGAATTTTACATCTTCCGCTTTCTCAGCGTGCTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUASTattb-cAMPr Y205A, R626A was a gift from Justin Blau (Addgene plasmid # 84932 ; http://n2t.net/addgene:84932 ; RRID:Addgene_84932) -
For your References section:
cAMPr: A single-wavelength fluorescent sensor for cyclic AMP. Hackley CR, Mazzoni EO, Blau J. Sci Signal. 2018 Mar 6;11(520). pii: 11/520/eaah3738. doi: 10.1126/scisignal.aah3738. 10.1126/scisignal.aah3738 PubMed 29511120