pAav-MCS-PQS2-3xHA
(Plasmid
#84917)
-
PurposerAAV-based template for genome engineering of protein C-termini containing PQS2 and 3xHA tags and a selection cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84917 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufactureragilent
- Backbone size w/o insert (bp) 4650
- Total vector size (bp) 4890
-
Vector typeAAV
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLOX-PGK-NEO-LOX
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1989
- Promoter mPGK
-
Tag
/ Fusion Protein
- PQS2 3xHA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CCTCTGACTTGAGCGTCGAT
- 3′ sequencing primer TACTATGGTTGCTTTGACGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Sequencing over ITR sequences may be difficult
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAav-MCS-PQS2-3xHA was a gift from Sven Eyckerman (Addgene plasmid # 84917 ; http://n2t.net/addgene:84917 ; RRID:Addgene_84917) -
For your References section:
An extra dimension in protein tagging by quantifying universal proteotypic peptides using targeted proteomics. Vandemoortele G, Staes A, Gonnelli G, Samyn N, De Sutter D, Vandermarliere E, Timmerman E, Gevaert K, Martens L, Eyckerman S. Sci Rep. 2016 Jun 6;6:27220. doi: 10.1038/srep27220. 10.1038/srep27220 PubMed 27264994