pCFJ1955
(Plasmid #84830)

• Purpose: Minimos transposon with Peft-3:tdTomato:tbb-2 3'UTR and cbr-unc-119 selection. tdTomato was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic introns
• Depositing Lab: Andrew Fire
• Publication: Frokjaer-Jensen et al Cell. 2016 Jul 14;166(2):343-57. doi: 10.1016/j.cell.2016.05.072. Epub 2016 Jun 30.

Backbone

• Vector backbone: pDESTR4-R3
• Backbone manufacturer: Invitrogen
• Vector type: Bacterial Expression, Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: C. elegans codon optimized tdTomato
• Species: C. elegans (nematode)
• Promoter: Peft-3

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gaacagctatgaccatgattacg
• 3′ sequencing primer: M13F

Resource Information

• Supplemental Documents:
  • pCFJ1955 - pEXP(ttTi5605, cbr-unc-119)[Peft-3 | ce-tdTomato(syntrons, NLS) | tbb-2 3UTR].gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Expression vector with C. elegans codon-optimized tdTomato under the eft-3 promoter and with the tbb-2 3'UTR.
Cloned into pCFJ150 for compatibility with mosSCI.
Contains cbr-unc-119 rescue fragment.