pLVX-EF1a-tetOn-IRES-G418 (EtO)
(Plasmid #84776)

• Purpose: Second generation lenti tetracycline operator (on)
• Depositing Lab: Fred Gage
• Publication: Mertens et al Cell Stem Cell. 2015 Oct 6. pii: S1934-5909(15)00408-7. doi: 10.1016/j.stem.2015.09.001.

Backbone

• Vector backbone: PLVX TIGHT PURO
• Backbone size w/o insert (bp): 7791
• Total vector size (bp): 12292
• Vector type: Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Depositing lab suggests using Stbl3. Large plasmid may behave similarly to a low copy number plasmid.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TET OPERATOR
• Promoter: pTIGHT

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GCAGAGCTCGTTTAGTG
• 3′ sequencing primer: CTAAAGCGCATGCTCCAGACTGCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: JEROME MERTENS
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry