pMRX-IP-GFP-LC3-RFP
(Plasmid #84573)

• Purpose: Expresses GFP-LC3-RFP in mammalian cells to measure autophagic flux
• Depositing Lab: Noboru Mizushima
• Publication: Kaizuka et al Mol Cell. 2016 Nov 17;64(4):835-849. doi: 10.1016/j.molcel.2016.09.037. Epub 2016 Nov 3.

Backbone

• Vector backbone: pMRX-IP
• Backbone manufacturer: Dr.Shoji Yamaoka of Tokyo Medical and Dental University
• Backbone size w/o insert (bp): 6100
• Total vector size (bp): 7900
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: microtubule-associated protein 1 light chain 3 beta
• Alt name: Map1lc3b
• Alt name: LC3
• Alt name: LC3B
• Species: R. norvegicus (rat)
• Insert Size (bp): 1800
• GenBank ID: U05784 NM_022867.2
• Entrez Gene: Map1lc3b (a.k.a. LC3B, Map1lc3, Mpl3, zbs559)
• Tags / Fusion Proteins:
  • EGFP (N terminal on insert)
  • mRFP1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl II (unknown if destroyed)
• 3′ cloning site: Bgl II (unknown if destroyed)
• 5′ sequencing primer: CGACCACTACCAGCAGAACA
• 3′ sequencing primer: AAAAGACGGCAATATGGTGG

Resource Information

• Supplemental Documents:
  • Tips for using GFP-LC3-RFP-(LC3dG)
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: It has the pMX backbone
• Articles Citing this Plasmid:
  • 31 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry