pHD157
(Plasmid
#84033)
-
PurposeVector for creating transgenic zebrafish. Expresses mCherry-Cre fusion protein under the fabp10 promoter and Venus under the crystalin promoter in zebrafish
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84033 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneunknown
-
Vector typeCre/Lox ; Zebrafish transgenesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCre
- Promoter fabp10
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga)
- 3′ sequencing primer SV40pA-R (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameVenus
- Promoter Crystalin
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer T3
- 3′ sequencing primer BGH-rev (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Designed in a pBluescript series vector containing I-SceI meganuclease sites. The I-SceI meganuclease method is a common method for establishing transgenic zebrafish lines.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHD157 was a gift from Daniel Hesselson & Didier Stainier (Addgene plasmid # 84033 ; http://n2t.net/addgene:84033 ; RRID:Addgene_84033) -
For your References section:
Conditional control of gene function by an invertible gene trap in zebrafish. Ni TT, Lu J, Zhu M, Maddison LA, Boyd KL, Huskey L, Ju B, Hesselson D, Zhong TP, Page-McCaw PS, Stainier DY, Chen W. Proc Natl Acad Sci U S A. 2012 Sep 18;109(38):15389-94. Epub 2012 Aug 20. 10.1073/pnas.1206131109 PubMed 22908272