Skip to main content
Addgene

pME-Cas9-T2A-GFP
(Plasmid #63155)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63155 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pME-MCS (Tol2Kit #237)
  • Backbone size w/o insert (bp) 2765
  • Total vector size (bp) 7685
  • Vector type
    CRISPR ; Tol2 Middle Entry vector for Gateway

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9-T2A-GFP
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    4984

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CCTACTCAGGAGAGCGTTCA
  • 3′ sequencing primer CAGGAAACAGCTATGACCAT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    the Chen laboratory (Jao et al., PNAS 2013).
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Reference for zebrafish codon-optimized Cas9:
Jao, L.E., Wente, S.R., and Chen, W. (2013). Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A 110, 13904-13909.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pME-Cas9-T2A-GFP was a gift from Leonard Zon (Addgene plasmid # 63155 ; http://n2t.net/addgene:63155 ; RRID:Addgene_63155)
  • For your References section:

    A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish. Ablain J, Durand EM, Yang S, Zhou Y, Zon LI. Dev Cell. 2015 Mar 4. pii: S1534-5807(15)00075-1. doi: 10.1016/j.devcel.2015.01.032. 10.1016/j.devcel.2015.01.032 PubMed 25752963