Skip to main content
Addgene

pET32bplus_trxAChEwt
(Plasmid #83916)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83916 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET32b+
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5848
  • Total vector size (bp) 7501
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Short form of hAChE, codon optimised for E.coli expression
  • Alt name
    hAChE-wt
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1653
  • Mutation
    codon optimised for E.coli expression
  • GenBank ID
    M55040.1
  • Entrez Gene
    ACHE (a.k.a. ACEE, ARACHE, N-ACHE, YT)
  • Promoter T7 promoter
  • Tags / Fusion Proteins
    • TRX (N terminal on backbone)
    • His (N terminal on backbone)
    • S-tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer aaattcgaacgccagcacatgg
  • 3′ sequencing primer caaaaaacccctcaagacccg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET32bplus_trxAChEwt was a gift from Sarel Fleishman (Addgene plasmid # 83916 ; http://n2t.net/addgene:83916 ; RRID:Addgene_83916)

  • For your References section:

    Automated Structure- and Sequence-Based Design of Proteins for High Bacterial Expression and Stability. Goldenzweig A, Goldsmith M, Hill SE, Gertman O, Laurino P, Ashani Y, Dym O, Unger T, Albeck S, Prilusky J, Lieberman RL, Aharoni A, Silman I, Sussman JL, Tawfik DS, Fleishman SJ. Mol Cell. 2016 Jul 21;63(2):337-46. doi: 10.1016/j.molcel.2016.06.012. Epub 2016 Jul 14. 10.1016/j.molcel.2016.06.012 PubMed 27425410
Related items:
Commonly requested with: