pET32bplus_trx_dAChE4
(Plasmid #83917)

• Purpose: Encodes an E. coli codon optimized version of dAChE4 - a designed variant of human acetylcholinesterase bearing 51 mutations with ~1800 fold higher functional expression levels in E. coli
• Depositing Lab: Sarel Fleishman
• Publication: Goldenzweig et al Mol Cell. 2016 Jul 21;63(2):337-46. doi: 10.1016/j.molcel.2016.06.012. Epub 2016 Jul 14.

Backbone

• Vector backbone: pET32b+
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5851
• Total vector size (bp): 7504
• Modifications to backbone: addition of three nucleotides, GTT, at 7339-7441
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Designed hAChE, codon optimised for E.coli expression
• Alt name: dAChE4
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1653
• Mutation: V13T,K24T,M43V,L49R,V61W,S68N,E92N,T110K,S111N,T113A,L116M,A128S,Q141R,A142T,T145V,V188I,V227I,G235A,T239Y,G241S,M242R,G243E,T250L,H254K,T276N,A279P,V281E,S310P,A319N,H323K,Q326D,V332N,A358E,A362E,V379I,R394K,L395N,E397D,V409I,L415F,G417Q,L419Y,Q422N,A435S,S439P,L442E,A468K,Q475R,G507D,A508E,Q510K
• GenBank ID: M55040.1
• Entrez Gene: ACHE (a.k.a. ACEE, ARACHE, N-ACHE, YT)
• Promoter: T7 promoter
• Tags / Fusion Proteins:
  • TRX (N terminal on backbone)
  • His (N terminal on backbone)
  • S-tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: aaattcgaacgccagcacatgg
• 3′ sequencing primer: caaaaaacccctcaagacccg

Resource Information

• Supplemental Documents:
  • pET32b+TRX+dAChE4.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry