pCW-Cas9-Blast
(Plasmid #83481)

• Purpose: Lentiviral vector for mammalian expression of doxycycline-inducible Cas9 and constitutive expression of Blasticidin S deaminaase -T2A -rtTA
• Depositing Lab: Mohan Babu
• Publication: CRISPR/Cas9-based system for loss-of-function screening (unpublished)

Backbone

• Vector backbone: pCW-Cas9 (#50661)
• Backbone manufacturer: Eric Lander, David Sabatini
• Backbone size w/o insert (bp): 11900
• Total vector size (bp): 11687
• Modifications to backbone: puromycin N-acetyltransferase was replaced by blasticidin S deaminase
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: No more than 16-hour culture.
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: SpCas9
• Mutation: Replaced puromycin N-acetyltransferase on the original plasmid
• Promoter: Tight Tre

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: Unknown
• 3′ sequencing primer: Unknown

Gene/Insert 2

• Gene/Insert name: Blasticidin S deaminase -T2A - reverse tetracycline-controlled transactivator
• Promoter: human phosphoglycerate kinase 1 promoter

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: O.PGK1b_F (CACATTCTTCACGTCCGTTC)
• 3′ sequencing primer: GTCGCGATGTGAGAGGAGAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Eric Lander, David Sabatini (backbone, pCW-Cas9, #50661), Feng Zhang (insert, lentiCas9-Blast #52962).
• Articles Citing this Plasmid:
  • 21 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Blasticidin gene was amplified from lentiCas9-Blast using primers F: TCTCCCCAGCAATTCACCatggccaagcctttgtctc, R: CAAGTGAGGAGAGAACCTCTACCTTCttagccctcccacacataacc. The PCR product was gel-purified and used to perform CPEC cloning on pCW-Cas9, as described in 21293463.

Because a previous version of this plasmid contained a STOP codon between the blasticidin resistance gene and rtTA, this stop codon was subsequently removed. The following primers were used to confirm removal of the STOP codon:
Forward primer: GTGTTCCGCATTCTGCAAG
Reverse primer: ACGTGCCAGTACAGGGTAGG