Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCW-Cas9-Blast
(Plasmid #83481)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83481 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCW-Cas9 (#50661)
  • Backbone manufacturer
    Eric Lander, David Sabatini
  • Backbone size w/o insert (bp) 11900
  • Total vector size (bp) 11687
  • Modifications to backbone
    puromycin N-acetyltransferase was replaced by blasticidin S deaminase
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    No more than 16-hour culture.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SpCas9
  • Mutation
    Replaced puromycin N-acetyltransferase on the original plasmid
  • Promoter Tight Tre

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Blasticidin S deaminase -T2A - reverse tetracycline-controlled transactivator
  • Promoter human phosphoglycerate kinase 1 promoter

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer O.PGK1b_F (CACATTCTTCACGTCCGTTC)
  • 3′ sequencing primer GTCGCGATGTGAGAGGAGAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Eric Lander, David Sabatini (backbone, pCW-Cas9, #50661), Feng Zhang (insert, lentiCas9-Blast #52962).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Blasticidin gene was amplified from lentiCas9-Blast using primers F: TCTCCCCAGCAATTCACCatggccaagcctttgtctc, R: CAAGTGAGGAGAGAACCTCTACCTTCttagccctcccacacataacc. The PCR product was gel-purified and used to perform CPEC cloning on pCW-Cas9, as described in 21293463.

Because a previous version of this plasmid contained a STOP codon between the blasticidin resistance gene and rtTA, this stop codon was subsequently removed. The following primers were used to confirm removal of the STOP codon:
Forward primer: GTGTTCCGCATTCTGCAAG
Reverse primer: ACGTGCCAGTACAGGGTAGG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-Cas9-Blast was a gift from Mohan Babu (Addgene plasmid # 83481 ; http://n2t.net/addgene:83481 ; RRID:Addgene_83481)

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out these options:

Learn More