pPHAGE_DLD-S456A-C-TAP
(Plasmid #83479)

• Purpose: Mammalian expression of the proteolysis-deficient mutant DLD-S456A.
• Depositing Lab: Mohan Babu
• Publication: Malty et al Cell Syst. 2017 Nov 7. pii: S2405-4712(17)30447-7. doi: 10.1016/j.cels.2017.10.010.

Backbone

• Vector backbone: pPHAGE C-TAP
• Backbone manufacturer: PMID: 26186194
• Backbone size w/o insert (bp): 10056
• Total vector size (bp): 9368
• Modifications to backbone: Partial removal of gateway cassette.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DLD
• Alt name: Dihydrolipoamide Dehydrogenase
• Species: H. sapiens (human)
• Mutation: S456A
• GenBank ID: NG_008045.1
• Entrez Gene: DLD (a.k.a. DLDD, DLDH, E3, GCSL, LAD, OGDC-E3, PHE3)
• Promoter: CMV
• Tag / Fusion Protein:
  • TAP (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CMV_F, mutation confirmation (CTCTTGGTTTGCATTGGCCG)
• 3′ sequencing primer: IRES_R

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The plasmid was originally developed by authors of the paper PMID: 26186194.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mutation (first described in PMID: 17404228) was created using the method described in PMID: 17446874. Two outer (F: CTCTTGGTTTGCATTGGCCG, IRES_R: CCTCACATTGCCAAAAGACG) and two mutation-site primers were used. The mutated PCR product and the backbone vector were digested using EcoRI, gel purified and ligated.

Note that the mutation is numbered in accordance with the original publication (PMID: 17404228), which lacked the mitochondrial targeting signal (residues 1-35). In this full-length protein, it is found at position 491.