Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX-XIAP
(Plasmid #8340)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 8340 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX
  • Backbone manufacturer
    amersham
  • Backbone size w/o insert (bp) 4900
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    XIAP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500
  • Entrez Gene
    XIAP (a.k.a. API3, BIRC4, IAP-3, ILP1, MIHA, XLP2, hIAP-3, hIAP3)
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTGG
  • 3′ sequencing primer TCCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-XIAP was a gift from Jon Ashwell (Addgene plasmid # 8340 ; http://n2t.net/addgene:8340 ; RRID:Addgene_8340)
  • For your References section:

    Ubiquitin protein ligase activity of IAPs and their degradation in proteasomes in response to apoptotic stimuli. Yang Y, Fang S, Jensen JP, Weissman AM, Ashwell JD. Science 2000 May 5;288(5467):874-7. 10.1126/science.288.5467.874 PubMed 10797013