pTRIPZ (M)-HT-CD(Cbx7)
(Plasmid #82520)

• Purpose: Lentivirus vector. Expresess mutant Halotag-CD-Cbx7 fusion proteins in mammalian cells. Express Chromodomain of Cbx7; amino acids 8–62.
• Depositing Lab: Xiaojun Ren
• Publication: pTRIPZ-MSC1-Halotag-Cbx2 (unpublished)

Backbone

• Vector backbone: pTRIPZ (M)
• Backbone size w/o insert (bp): 13100
• Total vector size (bp): 13304
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Chromobox Homolog 7
• Alt name: Cbx7
• Species: H. sapiens (human)
• Insert Size (bp): 168
• Mutation: amino acids 8–62
• GenBank ID: NM_175709
• Entrez Gene: CBX7
• Promoter: CMV
• Tag / Fusion Protein:
  • HaloTag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (unknown if destroyed)
• 3′ cloning site: Mlu1 (unknown if destroyed)
• 5′ sequencing primer: CGTCGACAGCCAGCGCGCGATCT
• 3′ sequencing primer: tcctcacggcgagcgctgccac

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry