pTRIPZ (M)-HT-Cbx7-Delta-ATL
(Plasmid
#82523)
-
PurposeLentivirus vector. Expresses mutant Halotag-Cbx7-delta-ATL fusion proteins in mammalian cells. Cbx7deletion of amino acids 66–83.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82523 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTRIPZ (M)
- Backbone size w/o insert (bp) 1300
- Total vector size (bp) 13814
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChromobox Homolog 7
-
Alt nameCbx7
-
SpeciesH. sapiens (human)
-
Insert Size (bp)702
-
Mutationdeletion of amino acids 66–83
-
GenBank IDNM_175709
-
Entrez GeneCBX7
- Promoter CMV
-
Tag
/ Fusion Protein
- HaloTag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (unknown if destroyed)
- 3′ cloning site Mlu1 (unknown if destroyed)
- 5′ sequencing primer CCGATCAGGTCCGGGTTGTCTT
- 3′ sequencing primer ctcacggcgagcgctgccacgtc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIPZ (M)-HT-Cbx7-Delta-ATL was a gift from Xiaojun Ren (Addgene plasmid # 82523 ; http://n2t.net/addgene:82523 ; RRID:Addgene_82523)