pGAPTrap-GFP
(Plasmid
#82506)
-
PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82506 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGAPTrap
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)1500
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Asc1 (destroyed during cloning)
- 3′ cloning site Cla1 (not destroyed)
- 5′ sequencing primer caacagggtggtggacctcatg
- 3′ sequencing primer cctcttcaaggggtctacatgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGAPTrap-GFP was a gift from Ed Stanley (Addgene plasmid # 82506 ; http://n2t.net/addgene:82506 ; RRID:Addgene_82506) -
For your References section:
GAPTrap: A Simple Expression System for Pluripotent Stem Cells and Their Derivatives. Kao T, Labonne T, Niclis JC, Chaurasia R, Lokmic Z, Qian E, Bruveris FF, Howden SE, Motazedian A, Schiesser JV, Costa M, Sourris K, Ng E, Anderson D, Giudice A, Farlie P, Cheung M, Lamande SR, Penington AJ, Parish CL, Thomson LH, Rafii A, Elliott DA, Elefanty AG, Stanley EG. Stem Cell Reports. 2016 Sep 1. pii: S2213-6711(16)30139-4. doi: 10.1016/j.stemcr.2016.07.015. 10.1016/j.stemcr.2016.07.015 PubMed 27594589