pGAPTrap-mCherry-IRESMygro
(Plasmid #82505)

• Purpose: Vector targeting the mCherry gene to the GAPDH locus of human cells. mCherry is expressed from a 2A sequence at the C terminus of GAPDH. Hygromycin B resistance is encoded by the Mygro gene.
• Depositing Lab: Ed Stanley
• Publication: Kao et al Stem Cell Reports. 2016 Sep 1. pii: S2213-6711(16)30139-4. doi: 10.1016/j.stemcr.2016.07.015.

Backbone

• Vector backbone: pGAPTrap
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry-IRESMygro
• Species: Synthetic
• Insert Size (bp): 2372

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Asc1 (destroyed during cloning)
• 3′ cloning site: Cla1 (not destroyed)
• 5′ sequencing primer: caacagggtggtggacctcatg
• 3′ sequencing primer: cctcttcaaggggtctacatgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry