TR-5'UTR-HP-GFP
(Plasmid
#80594)
-
PurposeExpresses GFP from the CBA promoter. Includes a Csy4 target hairpin in the 5'UTR for Csy4-mediated regulation. Cloned into an Adeno-Associated Virus backbone for packaging into AAV.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80594 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV ITR backbone
- Backbone size w/o insert (bp) 5237
- Total vector size (bp) 5957
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
-
Insert Size (bp)720
-
MutationInserted 30 nt hairpin which is targeted by Csy4 in the 5'UTR
- Promoter CBA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer caaatctgtgcggagccgaaatctgggagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TR-5'UTR-HP-GFP was a gift from Aravind Asokan (Addgene plasmid # 80594 ; http://n2t.net/addgene:80594 ; RRID:Addgene_80594) -
For your References section:
Controlling mRNA stability and translation with the CRISPR endoribonuclease Csy4. Borchardt EK, Vandoros LA, Huang M, Lackey PE, Marzluff WF, Asokan A. RNA. 2015 Nov;21(11):1921-30. doi: 10.1261/rna.051227.115. Epub 2015 Sep 9. 10.1261/rna.051227.115 PubMed 26354771