pBoxCDGC-KMet-EGFP
(Plasmid
#140272)
-
PurposeL7Ae-dependent translational repression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBoxCD
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer CTTTATTTGTAACCATTATAAGCTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternative name: p1-boxC/D-EGFP
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBoxCDGC-KMet-EGFP was a gift from Hirohide Saito (Addgene plasmid # 140272 ; http://n2t.net/addgene:140272 ; RRID:Addgene_140272) -
For your References section:
Synthetic translational regulation by an L7Ae-kink-turn RNP switch. Saito H, Kobayashi T, Hara T, Fujita Y, Hayashi K, Furushima R, Inoue T. Nat Chem Biol. 2010 Jan;6(1):71-8. doi: 10.1038/nchembio.273. Epub 2009 Dec 13. 10.1038/nchembio.273 PubMed 20016495