PB-TAC-EB-C5
(Plasmid #80485)

• Purpose: piggyBac transposon for dox-inducible expression of the EB-C5 polycistronic reprogramming cassette (with mCherry)
• Depositing Lab: Knut Woltjen
• Publication: Kim et al Stem Cell Reports. 2015 Apr 14;4(4):727-43. doi: 10.1016/j.stemcr.2015.02.004. Epub 2015 Mar 12.

Backbone

• Vector backbone: pBluescript
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 11904
• Vector type: Mammalian Expression ; piggyBac transposon

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: lin-28 homolog A (C. elegans)
• Species: M. musculus (mouse)
• Insert Size (bp): 5676
• Entrez Gene: Pou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
• Entrez Gene: Sox2 (a.k.a. Sox-2, lcc, ysb)
• Entrez Gene: Klf4 (a.k.a. EZF, Gklf, Zie)
• Entrez Gene: Myc (a.k.a. Myc2, Niard, Nird, bHLHe39)
• Entrez Gene: Lin28a (a.k.a. Gm10299, Lin-28, Lin28, Tex17, lin-28A)
• Promoter: tetO

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CCAAAAGACGGCAATATGGT
• 3′ sequencing primer: GCTGTTTTGACCTCCATAGAAGA

Resource Information

• Supplemental Documents:
  • Genbank

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Requires co-transfection with a piggyBac transposase plasmid for stable genomic integration. If you desire to use transposase with the Materials, you may contact Transposagen or other licensed vendor.