-
Purpose(Empty Backbone) Transient expression vector for eGFP in plants
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80127 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC18
-
Backbone manufacturerClonech
- Backbone size (bp) 2686
-
Vector typePlant Expression
- Promoter CaMV35S
-
Tag
/ Fusion Protein
- eGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGATCCATGGTGAGCAAGGGCGAGGAGCTG
- 3′ sequencing primer TTACTTGTACAGCTCGTCCATGCCGAGAGT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
35S-eGFP-nosT was a gift from Yutaka Kodama (Addgene plasmid # 80127 ; http://n2t.net/addgene:80127 ; RRID:Addgene_80127) -
For your References section:
In planta comparative analysis of improved green fluorescent proteins with reference to fluorescence intensity and bimolecular fluorescence complementation ability. Fujii Y, Kodama Y. Plant Biotech. 2015; 32(1): 81-87. 10.5511/plantbiotechnology.15.0120a