pCAG-eCas9-GFP-U6-gRNA
(Plasmid #79145)

• Purpose: All-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in human pluripotent stem cells
• Depositing Lab: Jizhong Zou
• Publication: pCAG-SpCas9-U6-gRNA (unpublished)

Backbone

• Vector backbone: eSpCas9(1.1)
• Backbone manufacturer: Addgene #71814
• Total vector size (bp): 10243
• Modifications to backbone: Added 2A-GFP to the C-terminal of eSpCas9(1.1) and replaced CBh promoter with CAG promoter
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eSpCas9(1.1)
• Promoter: CAG
• Tag / Fusion Protein:
  • 2A-GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (not destroyed)
• 3′ cloning site: BbsI (not destroyed)
• 5′ sequencing primer: ACTATCATATGCTTACCGTAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This plasmid was modified from Addgene plasmid #71814 and contains GFP cassette.
• Articles Citing this Plasmid:
  • 14 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry