mCherry-Rab9a
(Plasmid #78592)

• Purpose: Express mCherry-Rab9a in mammalian cells
• Depositing Lab: Yihong Ye
• Publication: Lee et al Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13.

Backbone

• Vector backbone: mCherry2-C1
• Backbone size w/o insert (bp): 4750
• Total vector size (bp): 5400
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rab9a
• Species: H. sapiens (human)
• Insert Size (bp): 678
• GenBank ID: NM_004251
• Entrez Gene: RAB9A (a.k.a. RAB9)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry2

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GCTGCAATAAACAAGTTAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We received this vector from Michael Davidson (Addgene plasmid # 54563) and inserted Rab9a PCR from GFP-rab9 WT (Richard Pagano, Addgene plasmid #12663)
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry