Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

766_SMAD4 in pmiRGlo
(Plasmid #78130)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78130 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmiRGlo
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SMAD4
  • Species
    H. sapiens (human)
  • Mutation
    3'UTR containing miRNA binding sites
  • Entrez Gene
    SMAD4 (a.k.a. DPC4, JIP, MADH4, MYHRS)
  • Promoter PGK
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer Fluc-F1 (AGAAGCTGCGCGGTGGTGTTGTG)
  • 3′ sequencing primer T7terminal
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    766_SMAD4 in pmiRGlo was a gift from Heidi Schwarzenbach (Addgene plasmid # 78130 ; http://n2t.net/addgene:78130 ; RRID:Addgene_78130)
  • For your References section:

    Increased serum levels of circulating exosomal microRNA-373 in receptor-negative breast cancer patients. Eichelser C, Stuckrath I, Muller V, Milde-Langosch K, Wikman H, Pantel K, Schwarzenbach H. Oncotarget. 2014 Oct 30;5(20):9650-63. 10.18632/oncotarget.2520 PubMed 25333260