PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins
(Plasmid #78099)

• Purpose: Nuclear fluorescent reporter in mammalian cells, phiC31 attB for integration, can be silenced with TetR-CR or rTetR-CR (e.g. CR can be KRAB or DNMT3B).
• Depositing Lab: Michael Elowitz
• Publication: Bintu et al Science. 2016 Feb 12;351(6274):720-4. doi: 10.1126/science.aab2956.

Backbone

• Vector backbone: pSLR-test
• Backbone manufacturer: Toyobo, Osaka, Japan
• Backbone size w/o insert (bp): 9432
• Total vector size (bp): 12550
• Modifications to backbone: replaced the SLR gene with Neo (blunt-end ligation after digesting pSLR-test with EcoRV/SmaI, see PLoS One 6.2 (2011): e17267) introduced MCS with 2 cHS4 insulators on each side
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Histone H2B - Citrine
• Alt name: histone cluster 2, H2be
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 3080
• GenBank ID: https://www.ncbi.nlm.nih.gov/gene/8349
• Entrez Gene: H2BC21 (a.k.a. GL105, H2B, H2B-GL105, H2B.1, H2BE, H2BFQ, H2BGL105, H2BQ, HIST2H2BE)
• Promoter: 5xTetO pEF alpha

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCIF_3 GAAGACGTCGATATACGCGT
• 3′ sequencing primer: TCIR_5 GGAGCTCCACCCTAGAACTA

Resource Information

• Supplemental Documents:
  • phiC31_attB_Neo_ins_TRE_citrine_ins
• A portion of this plasmid was derived from a plasmid made by: PhiC31-Neo-ins-MCS-ins was a gift from Mitsuo Oshimura. pCS-H2B-citrine was a gift from Sean Megasson.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Can be used for constitutive expression of H2B-citrine.
Can be silenced by TetR-KRAB or rTetR-KRAB (using doxycycline).
It can be site-specifically integrated in a PhiC31 attP site (the plasmid contains a PhiC31 attB site).
The reporter gene is flanked by two full length (1.2kb each) chicken HS4 insulators on each side.