Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTrcECT
(Plasmid #75477)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75477 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTrc99a
  • Backbone manufacturer
    Pharmacia
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ectABC
  • Species
    E.coli
  • Insert Size (bp)
    2550
  • GenBank ID
    9747780, 9747563 and 9747564
  • Promoter trc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer PTrcPro-F acaattaatcatccggctcg
  • 3′ sequencing primer rrnB-T1-term-Rev GAAAGGCCCAGTCTTTCGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTrcECT was a gift from Xixian Xie (Addgene plasmid # 75477 ; http://n2t.net/addgene:75477 ; RRID:Addgene_75477)
  • For your References section:

    Pathway construction and metabolic engineering for fermentative production of ectoine in Escherichia coli. Ning Y, Wu X, Zhang C, Xu Q, Chen N, Xie X. Metab Eng. 2016 Mar 9;36:10-18. doi: 10.1016/j.ymben.2016.02.013. 10.1016/j.ymben.2016.02.013 PubMed 26969253