pTrcECT
(Plasmid
#75477)
-
PurposeInducible expression of ectABC in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75477 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTrc99a
-
Backbone manufacturerPharmacia
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameectABC
-
SpeciesE.coli
-
Insert Size (bp)2550
-
GenBank ID9747780, 9747563 and 9747564
- Promoter trc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer PTrcPro-F acaattaatcatccggctcg
- 3′ sequencing primer rrnB-T1-term-Rev GAAAGGCCCAGTCTTTCGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrcECT was a gift from Xixian Xie (Addgene plasmid # 75477 ; http://n2t.net/addgene:75477 ; RRID:Addgene_75477) -
For your References section:
Pathway construction and metabolic engineering for fermentative production of ectoine in Escherichia coli. Ning Y, Wu X, Zhang C, Xu Q, Chen N, Xie X. Metab Eng. 2016 Mar 9;36:10-18. doi: 10.1016/j.ymben.2016.02.013. 10.1016/j.ymben.2016.02.013 PubMed 26969253