pCas9-VRER_2A_GFP
(Plasmid #75475)

• Purpose: Cas9 VRER variant that detects NGCG PAM, combined with 2A_GFP for expression control
• Depositing Lab: Marc Tessier-Lavigne
• Publication: Paquet et al Nature. 2016 May 5;533(7601):125-9. doi: 10.1038/nature17664. Epub 2016 Apr 27.

Backbone

• Vector backbone: pCAG
• Backbone size w/o insert (bp): 4200
• Total vector size (bp): 9271
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cas9-VRER
• Species: Synthetic; human codon-optimized
• Insert Size (bp): 4137
• Mutation: D1135V, G1218R, R1335E, T1337R
• Promoter: CAG
• Tag / Fusion Protein:
  • 2A_GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: None (destroyed during cloning)
• 5′ sequencing primer: ggctctagtgcctctgctaacc
• 3′ sequencing primer: M13R

Resource Information

• Supplemental Documents:
  • pCas9-VRER_2A_GFP.gb
• A portion of this plasmid was derived from a plasmid made by: Plasmid is modified from pCas9_GFP, originally received from Addgene (Plasmid #44719), please check MTA for original plasmid.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry