-
PurposePlasmid for mf-lon mediated mCherry degradation in Lactococcus lactis. Contains mcherry-pdt3
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75441 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepZE11
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemf-lon
-
SpeciesMesoplasma florum
- Promoter nisA promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacII (not destroyed)
- 3′ cloning site AatII (not destroyed)
- 5′ sequencing primer AGTCTTATAACTATACTGACAATAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pECGMC3 was a gift from James Collins (Addgene plasmid # 75441 ; http://n2t.net/addgene:75441 ; RRID:Addgene_75441) -
For your References section:
Tunable protein degradation in bacteria. Cameron DE, Collins JJ. Nat Biotechnol. 2014 Dec;32(12):1276-81. doi: 10.1038/nbt.3053. Epub 2014 Nov 17. 10.1038/nbt.3053 PubMed 25402616
Map uploaded by the depositor.
