-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTRKH3
- Backbone size w/o insert (bp) 7493
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameerythromycin ribosomal methylase promoter region fused with modified green fluorescent protein 5
-
Alt nameEnterococcus faecalis ermB promoter
-
Alt namesynthetic construct mgfp5
-
SpeciesEnterococcus faecalis and synthetic construct
-
Insert Size (bp)1279
-
Mutationpresence of an additional 183-bp region at N terminal on insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AGTGAAAAGTTCTTCTCCTT
- 3′ sequencing primer GCGGCACGACTTCTTCAAGAGC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRKH3-ermGFP was a gift from Michela Lizier (Addgene plasmid # 27169 ; http://n2t.net/addgene:27169 ; RRID:Addgene_27169) -
For your References section:
Comparison of expression vectors in Lactobacillus reuteri strains. Lizier M, Sarra PG, Cauda R, Lucchini F. FEMS Microbiol Lett. 2010 Jul 1. 308(1):8-15. 10.1111/j.1574-6968.2010.01978.x PubMed 20455948