Sfp pet29b C-terminal His Tag
(Plasmid #75015)

• Purpose: Expresses the PPTase Sfp from B. subtilis; loads CoA analogues onto ACP
• Depositing Lab: Michael Burkart
• Publication: Worthington et al Org Biomol Chem. 2006 Jan 7;4(1):44-6. Epub 2005 Nov 24.

Backbone

• Vector backbone: pet29b
• Backbone size w/o insert (bp): 5370
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For protein expression grow in BL21s at 37 degrees until OD 0.8 is reached (approximately 4-6 hours), induce with 0.5 mM IPTG and grow at 16 degrees for 16 hours.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sfp
• Alt name: 4'-phosphopantetheinyl transferase
• Species: B. subtilis
• GenBank ID: X63158.1
• Promoter: T7
• Tag / Fusion Protein:
  • His Tag (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TAATACGACTCACTATAGGG (T7 promoter, forward primer)
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG (T7 terminator, reverse primer)

Resource Information

• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry