pBGN155
(Plasmid
#74992)
-
Purpose(Empty Backbone) GFP(S65T)-based BiFC vector for transient expression of sGN (1-155) in plants
-
Depositing Labs
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74992 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneCaMV35S- sGFP(S65T)-NOS vector
-
Backbone manufacturerChiu W
- Backbone size (bp) 4180
-
Modifications to backboneReplaced sGFP to 1-155 fragments of GFP
-
Vector typePlant Expression ; Reporter plasmid
- Promoter CaMV35S
-
Tag
/ Fusion Protein
- GFP (1–155)/GN155
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGATCCATGGTGAGCAAGGGCGAGGAGCTG
- 3′ sequencing primer TTACTTGTACAGGGCCATGATATAGACGTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBGN155 was a gift from Yutaka Kodama & Masamitsu Wada (Addgene plasmid # 74992 ; http://n2t.net/addgene:74992 ; RRID:Addgene_74992) -
For your References section:
Simultaneous visualization of two protein complexes in a single plant cell using multicolor fluorescence complementation analysis. Kodama Y, Wada M. Plant Mol Biol. 2009 May;70(1-2):211-7. doi: 10.1007/s11103-009-9467-0. Epub 2009 Feb 14. 10.1007/s11103-009-9467-0 PubMed 19219406
Map uploaded by the depositor.
