pGM32DEST
(Plasmid #74747)

• Purpose: Encodes for the QF-GR recombinant gene, splice linker, and mCherry reporter gene
• Depositing Labs: Jordan Ward, Keith Yamamoto
• Publication: Monsalve et al Genetics. 2019 Feb;211(2):419-430. doi: 10.1534/genetics.118.301705. Epub 2018 Nov 30.

Backbone

• Vector backbone: pUCTCAPR3-GW
• Total vector size (bp): 10043
• Vector type: Worm Expression
• Selectable markers: mCherry

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Gateway cassette
• Species: C. elegans (nematode)
• Insert Size (bp): 1704

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGGAAACAGCTATGACCATG

Gene/Insert 2

• Gene/Insert name: QF-GR
• Species: H. sapiens (human), Synthetic; Neurospora crassa
• Insert Size (bp): 3222
• GenBank ID: NCBI Gene ID: 2908
• Entrez Gene: NR3C1 (a.k.a. GCCR, GCR, GCRST, GR, GRL)
• Promoter: No promoter
• Tag / Fusion Protein:
  • Fusion of the Neurospora crassa QF activator to the ligand-binding domain from the Homo sapiens Glucocorticoid Receptor

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtgtacctaccaggccagtccc
• 3′ sequencing primer: ACCTGAGAGAAGACGGGTGATGCT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Kang Shen Laboratory, Stanford University

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

bioRxiv doi.org/10.1101/445833