Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGM32DEST
(Plasmid #74747)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74747 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUCTCAPR3-GW
  • Total vector size (bp) 10043
  • Vector type
    Worm Expression
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Gateway cassette
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1704

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    QF-GR
  • Species
    H. sapiens (human), Synthetic; Neurospora crassa
  • Insert Size (bp)
    3222
  • GenBank ID
    NCBI Gene ID: 2908
  • Entrez Gene
    NR3C1 (a.k.a. GCCR, GCR, GCRST, GR, GRL)
  • Promoter No promoter
  • Tag / Fusion Protein
    • Fusion of the Neurospora crassa QF activator to the ligand-binding domain from the Homo sapiens Glucocorticoid Receptor

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtgtacctaccaggccagtccc
  • 3′ sequencing primer ACCTGAGAGAAGACGGGTGATGCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Kang Shen Laboratory, Stanford University

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGM32DEST was a gift from Jordan Ward & Keith Yamamoto (Addgene plasmid # 74747 ; http://n2t.net/addgene:74747 ; RRID:Addgene_74747)
  • For your References section:

    A New Tool for Inducible Gene Expression in Caenorhabditis elegans. Monsalve GC, Yamamoto KR, Ward JD. Genetics. 2019 Feb;211(2):419-430. doi: 10.1534/genetics.118.301705. Epub 2018 Nov 30. 10.1534/genetics.118.301705 PubMed 30504365