pEF-hSEMA4C-Fc
(Plasmid #74449)

• Purpose: Expresses human Semaphorin-4C ectodomain fused to human Fc in mammalian cells
• Depositing Lab: Roland Friedel
• Publication: Le et al Oncotarget. 2015 Mar 30;6(9):7293-304.

Backbone

• Vector backbone: pEF-BOS
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 8696
• Modifications to backbone: The plasmid pEF-BOS-hSEMA4D-Fc (Kumanogoh et al., 2000) was modified by cutting out the Sema4D-ectodomain and inserting a SEMA4C ectodomain fragment.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human Semaphorin-4C ectodomain with human Fc tag
• Species: H. sapiens (human)
• Insert Size (bp): 3261
• GenBank ID: NM_017789.4
• Entrez Gene: SEMA4C (a.k.a. M-SEMA-F, SEMACL1, SEMAF, SEMAI)
• Promoter: EF1-alpha
• Tag / Fusion Protein:
  • human Fc tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: EF-F CATTCTCAAGCCTCAGACAGTGGT

Resource Information

• Supplemental Documents:
  • Annotated Genbank
• A portion of this plasmid was derived from a plasmid made by: The hSEMA4C ectodomain fragment was amplified by PCR from the cDNA plasmid IMAGE #40035252

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry