-
PurposegRNA_B to knockout human AMPK alpha 2 using Cas9n
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74377 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX462
-
Backbone manufacturerAddgene plasmid 48141
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman AMPK alpha 2 exon1 gRNA
-
Alt namePRKAA2
-
gRNA/shRNA sequenceGAAGATCGGACACTACGTGC
-
SpeciesH. sapiens (human)
-
Entrez GenePRKAA2 (a.k.a. AMPK, AMPK2, AMPKa2, PRKAA)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX462-hPRKAA2-gRNA_B was a gift from Reuben Shaw (Addgene plasmid # 74377 ; http://n2t.net/addgene:74377 ; RRID:Addgene_74377) -
For your References section:
Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Toyama EQ, Herzig S, Courchet J, Lewis TL Jr, Loson OC, Hellberg K, Young NP, Chen H, Polleux F, Chan DC, Shaw RJ. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138. 10.1126/science.aab4138 PubMed 26816379