Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pX462-hPRKAA1-gRNA_A
(Plasmid #74374)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74374 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX462
  • Backbone manufacturer
    Addgene plasmid 48141
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human AMPK alpha 1 exon1 gRNA
  • Alt name
    PRKAA1
  • gRNA/shRNA sequence
    GGCTGTCGCCATCTTTCTCC
  • Species
    H. sapiens (human)
  • Entrez Gene
    PRKAA1 (a.k.a. AMPK, AMPK alpha 1, AMPKa1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX462-hPRKAA1-gRNA_A was a gift from Reuben Shaw (Addgene plasmid # 74374 ; http://n2t.net/addgene:74374 ; RRID:Addgene_74374)
  • For your References section:

    Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Toyama EQ, Herzig S, Courchet J, Lewis TL Jr, Loson OC, Hellberg K, Young NP, Chen H, Polleux F, Chan DC, Shaw RJ. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138. 10.1126/science.aab4138 PubMed 26816379