Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

nls-Flamindo2
(Plasmid #73939)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73939 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1 (-)
  • Backbone size w/o insert (bp) 5359
  • Total vector size (bp) 6622
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    nls-Flamindo2
  • Insert Size (bp)
    1263
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CMV Forward CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nls-Flamindo2 was a gift from Tetsuya Kitaguchi (Addgene plasmid # 73939 ; http://n2t.net/addgene:73939 ; RRID:Addgene_73939)
  • For your References section:

    Genetically-encoded yellow fluorescent cAMP indicator with an expanded dynamic range for dual-color imaging. Odaka H, Arai S, Inoue T, Kitaguchi T. PLoS One. 2014 Jun 24;9(6):e100252. doi: 10.1371/journal.pone.0100252. eCollection 2014. PONE-D-14-08126 [pii] PubMed 24959857