pTT3 Unc5D-FLAG
(Plasmid #72197)

• Purpose: Expresses full-length Unc5d with a C-terminal FLAG tag
• Depositing Lab: Woj Wojtowicz
• Publication: Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149.

Backbone

• Vector backbone: pTT3
• Backbone manufacturer: Yves Durocher, National Research Council of Canada-Biotechnology Research Institute
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Unc5d
• Alt name: Unc5h4
• Alt name: NCBI gene ID 210801; Reference sequence XM_006509055.3
• Species: M. musculus (mouse)
• GenBank ID: XM_006509055.3
• Entrez Gene: Unc5d (a.k.a. D930029E11Rik, Unc5h4, mKIAA1777)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: SpeI (destroyed during cloning)
• 5′ sequencing primer: CAGTTTCCAAAAACGAGGAGG
• 3′ sequencing primer: TATGTCCTTCCGAGTGAGAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry