pTT3 Unc5C-FLAG
(Plasmid
#72196)
-
PurposeExpresses full-length Unc5c with a C-terminal FLAG tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72196 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTT3
-
Backbone manufacturerYves Durocher, National Research Council of Canada-Biotechnology Research Institute
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUnc5c
-
Alt nameUnc5h3; rcm
-
Alt nameNCBI gene ID 22253; Reference sequence NM_009472.4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2823
-
Entrez GeneUnc5c (a.k.a. B130051O18Rik, Unc5h3, rcm)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CAGTTTCCAAAAACGAGGAGG
- 3′ sequencing primer TATGTCCTTCCGAGTGAGAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTT3 Unc5C-FLAG was a gift from Woj Wojtowicz (Addgene plasmid # 72196 ; http://n2t.net/addgene:72196 ; RRID:Addgene_72196) -
For your References section:
An extracellular biochemical screen reveals that FLRTs and Unc5s mediate neuronal subtype recognition in the retina. Visser JJ, Cheng Y, Perry SC, Chastain AB, Parsa B, Masri SS, Ray TA, Kay JN, Wojtowicz WM. Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149. 10.7554/eLife.08149 PubMed 26633812