pPRIME-dsRed-shscramble
(Plasmid #71384)

• Purpose: Expresses dsRed and scramble shRNA under the control of the CMV promoter in eukaryotic cells
• Depositing Lab: William Wisden
• Publication: Yu et al Neuron. 2015 Jun 17. pii: S0896-6273(15)00516-4. doi: 10.1016/j.neuron.2015.06.003.

Backbone

• Vector backbone: pUC
• Total vector size (bp): 8564
• Vector type: Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Plasmid has both Ampicllin and Chloramphenicol resistance, but you only need to grow it in Ampicillin; no need to use Chloramphenicol as well
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CMV promoter-dsRed-mir30-shscramble
• Species: Synthetic; Discosoma coral
• Insert Size (bp): 4000
• Promoter: CMV enhancer/promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: ATCAACGTCTCATTTTCGCCAAAAGTT
• 3′ sequencing primer: GAAGTGATCTTCCGTCACAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: this plasmid is modified from the pRIME system. See: Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102, 13212–13217 We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664) to make pPRIME-dsRed-scramble

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

this plasmid is modified from the pRIME system. See:
Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A
lentiviral microRNA-based system for single-copy polymerase II-regulated
RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102,
13212–13217
We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664) to make pPRIME-dsRed-scramble