-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 28014 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV2/1
- Backbone size w/o insert (bp) 5037
-
Vector typeAAV ; adeno associate viral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Insert Size (bp)718
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ageI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TCGGCTTCTGGCGTGTGACCGG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
with ITRs, this vector is easy to have recombination. Check with multiple restriction digestions.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CAG-GFP was a gift from Karel Svoboda (Addgene plasmid # 28014 ; http://n2t.net/addgene:28014 ; RRID:Addgene_28014) -
For your References section:
Long-Range Neuronal Circuits Underlying the Interaction between Sensory and Motor Cortex. Mao T, Kusefoglu D, Hooks BM, Huber D, Petreanu L, Svoboda K. Neuron. 2011 Oct 6;72(1):111-23. 10.1016/j.neuron.2011.07.029 PubMed 21982373