pAAV EF1a DIO iChloC 2A dsRed
(Plasmid #70762)

• Purpose: An improved chloride-conducting channelrhodopsin for light-induced inhibition of neuronal activity in vivo. Cre inducible expression (double floxed inversed ORF)
• Depositing Lab: Thomas Oertner
• Publication: Wietek et al Sci Rep. 2015 Oct 7;5:14807. doi: 10.1038/srep14807.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5601
• Total vector size (bp): 8007
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Channelrhodopsin-2
• Alt name: ChR2, iChloC
• Species: Synthetic; Chlamydomonas
• Insert Size (bp): 927
• Mutation: E83Q,E90R,E101S,D156N,T159C
• Promoter: EF1a

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GGGATTCTCCTCCACGTCACCGC
• 3′ sequencing primer: GTAATCCAGAGGTTGATTATCG

Gene/Insert 2

• Gene/Insert name: red fluorescent protein
• Alt name: dsRed
• Species: Discoma sp.
• Promoter: EF1a

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: gagtttggatcttggttc
• 3′ sequencing primer: GGCAGAGGAAGTCTTCTAACAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ChR originally from P.Hegemann, HU-Berlin Germany tDimer originally form R.Tsien USD USA
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry