Skip to main content
Addgene

pAAV CaMKIIa iChloC 2A tDimer
(Plasmid #66709)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66709 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5384
  • Total vector size (bp) 7826
  • Modifications to backbone
    CaMKIIa promoter
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Channelrhodopsin-2
  • Alt name
    ChR2, iChloC
  • Species
    Synthetic; Chlamydomonas
  • Insert Size (bp)
    927
  • Mutation
    E83Q,E90R,E101S,D156N,T159C
  • Promoter CaMKIIa

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CAGGGCAAAGAGGAGCAGG
  • 3′ sequencing primer GATTCTCCTCCACGTCACCGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
    tDimer 2
  • Species
    Discoma sp.
  • Insert Size (bp)
    1395
  • Promoter CaMKIIa

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggcagaggaagtcttctaacat
  • 3′ sequencing primer gtaatccagaggttgattatcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ChR originally from P.Hegemann, HU-Berlin Germany tDimer originally form R.Tsien USD USA
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV CaMKIIa iChloC 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 66709 ; http://n2t.net/addgene:66709 ; RRID:Addgene_66709)
  • For your References section:

    An improved chloride-conducting channelrhodopsin for light-induced inhibition of neuronal activity in vivo. Wietek J, Beltramo R, Scanziani M, Hegemann P, Oertner TG, Simon Wiegert J. Sci Rep. 2015 Oct 7;5:14807. doi: 10.1038/srep14807. 10.1038/srep14807 PubMed 26443033