pWKS1583
(Plasmid #70188)

• Purpose: Modular vector for secreted amylase reporter expression
• Depositing Lab: Wiep Klaas Smits
• Publication: Oliveira Paiva et al ACS Synth Biol. 2016 Jun 23.

Backbone

• Vector backbone: pRPF185
• Backbone manufacturer: Fagan and Fairweather 2009
• Backbone size w/o insert (bp): 7216
• Total vector size (bp): 9178
• Modifications to backbone: Replaced gusA from original pRPF185 with amyEopt
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): MC1061
• Growth instructions: For E.coli, use Cm at 20ug/mL for growth on solid media, but 10ug/mL for growth in liquid medium. For C. difficile use thiamphenicol at 15ug/mL.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: amyEopt
• Alt name: secreted alpha-amylase
• Species: Synthetic
• Insert Size (bp): 1962
• Promoter: Ptet

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: NF_1323 (CTGGACTTCATGAAAAACTAAAAAAAATATTG)
• 3′ sequencing primer: NF_794 (CACCGACGAGCAAGGCAAGACCG)

Resource Information

• Supplemental Documents:
  • Geneious annotated plasmid map
  • Genbank-70188-pWKS1583

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: the depositing lab has determined that a particular IS element present in E. coli strains such as DH5alpha and its derivatives has a high propensity to insert into this plasmid. The depositing lab recommends isolating the plasmid DNA and transforming into a strain similar to MC1061.

Publication describing the backbone vector pRPF185 as well as the sequencing primers:
Clostridium difficile has two parallel and essential Sec secretion systems. Fagan RP, Fairweather NF. J Biol Chem. 2011 Aug 5;286(31):27483-93. doi: 10.1074/jbc.M111.263889. Epub 2011 Jun 9.
PMID: 21659510