pLenti-CaMKIIa-SpyTag-C1C2-mCherry
(Plasmid
#69833)
-
PurposeLentiviral vector with CaMKIIa promoter and upstream CMV promoter expressing SpyTag-C1C2-mCherry fusion. SpyTag can be used to monitor membrane localization of the C1C2 opsin.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69833 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti-CamKIIa
- Backbone size w/o insert (bp) 9252
- Total vector size (bp) 11112
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpyTag-C1C2
-
SpeciesChlamydomonas reinhardtii
-
Insert Size (bp)1860
-
MutationInserted SpyTag after the signal peptide of C1C2.
- Promoter CamKIIa
-
Tags
/ Fusion Proteins
- Trafficking signal
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTGGATGCTGACGAAGGCTC
- 3′ sequencing primer AAAGCAGCGTATCCACATAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CaMKIIa-SpyTag-C1C2-mCherry was a gift from Viviana Gradinaru (Addgene plasmid # 69833 ; http://n2t.net/addgene:69833 ; RRID:Addgene_69833) -
For your References section:
Genetically Encoded Spy Peptide Fusion System to Detect Plasma Membrane-Localized Proteins In Vivo. Bedbrook CN, Kato M, Ravindra Kumar S, Lakshmanan A, Nath RD, Sun F, Sternberg PW, Arnold FH, Gradinaru V. Chem Biol. 2015 Aug 20;22(8):1108-21. doi: 10.1016/j.chembiol.2015.06.020. Epub 2015 Jul 23. 10.1016/j.chembiol.2015.06.020 PubMed 26211362