pcDNA3.2/DEST/hTfR-HA
(Plasmid #69610)

• Purpose: human transferrin receptor with an HA tag fused at the C-terminus
• Depositing Lab: Robin Shaw
• Publication: Smyth et al Circ Res. 2012 Mar 30;110(7):978-89. Epub 2012 Feb 9.

Backbone

• Vector backbone: pcDNA3.2-HA/Dest (converted from pcDNA3.2-V5/Dest)
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 7699
• Total vector size (bp): 7771
• Modifications to backbone: pcDNA3.2-V5/Dest was converted to pcDNA3.2-HA/Dest by first introducing unique NotI and XhoI sites by sire-directed mutagenesis, followed by ligation of annealed HA-stop peptide.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human transferrin receptor
• Alt name: TfR
• Species: H. sapiens (human)
• Insert Size (bp): 2283
• GenBank ID: BC001188
• Entrez Gene: TFRC (a.k.a. CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (C terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: T7 forward primer
• 3′ sequencing primer: TfR internal primer (5' CGCTGCCAGCTTTACTGGAG 3')

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry