AAV-DeltaJunD
(Plasmid
#68547)
-
PurposeAAV expression of DeltaJunD
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4650
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDeltaJunD-IRES-GFP
-
Alt namejun D proto-oncogene
-
Alt nameJunD
-
Mutationtruncated splice variant
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pCAX-F CAGCTCCTGGGCAACGTGC
- 3′ sequencing primer hGH-PA-R CCAGCTTGGTTCCCAATAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-DeltaJunD was a gift from Eric Nestler (Addgene plasmid # 68547 ; http://n2t.net/addgene:68547 ; RRID:Addgene_68547) -
For your References section:
DeltaFosB induction in orbitofrontal cortex mediates tolerance to cocaine-induced cognitive dysfunction. Winstanley CA, LaPlant Q, Theobald DE, Green TA, Bachtell RK, Perrotti LI, DiLeone RJ, Russo SJ, Garth WJ, Self DW, Nestler EJ. J Neurosci. 2007 Sep 26;27(39):10497-507. 10.1523/JNEUROSCI.2566-07.2007 PubMed 17898221