Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-DeltaFosB
(Plasmid #68545)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 68545 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4650
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DeltaFosB-IRES-GFP
  • Alt name
    FosB
  • Mutation
    truncated splice variant of FosB
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pCAX-F CAGCTCCTGGGCAACGTGC
  • 3′ sequencing primer hGH-PA-R CCAGCTTGGTTCCCAATAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-DeltaFosB was a gift from Eric Nestler (Addgene plasmid # 68545 ; http://n2t.net/addgene:68545 ; RRID:Addgene_68545)
  • For your References section:

    An essential role for DeltaFosB in the nucleus accumbens in morphine action. Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchman T, Berton O, Sim-Selley LJ, Dileone RJ, Kumar A, Nestler EJ. Nat Neurosci. 2006 Feb;9(2):205-11. Epub 2006 Jan 15. 10.1038/nn1636 PubMed 16415864